circad | circRNAs associated with diseases

Hsa_circ_001569
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink		PMID	31104012
Experimental Method
Sample Type	Cell lines	Comparison	One normal human breast epithelial cell line, MCF10A, and four human breast cancer cell lines including MCF-7, MDA-MB-468, MDAMB-231 and MDAMB-453
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCCCTGAACATTCTCCCCAT Reverse GAAAGCACTTGGTGAAGTCGG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Xu, JH, Wang, Y, Xu, D (2019). Hsa_circ_001569 is an unfavorable prognostic factor and promotes cell proliferation and metastasis by modulating PI3K-AKT pathway in breast cancer. Cancer Biomark, 25, 2:193-201.